View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0559_low_30 (Length: 293)
Name: NF0559_low_30
Description: NF0559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0559_low_30 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 228
Target Start/End: Original strand, 20526890 - 20527099
Alignment:
| Q |
19 |
catgacatccaagcacaaacaaacgagttcagttttgagtaataagagttgcaacttgcaagcttgaaattataaagcatgctaactgaaataatcacaa |
118 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20526890 |
catgacatccaagcacaaacaaaagagttcagttttgagtaataagagttgcaacttgcaagcttgaaattataaagcatgctaactgaaataatcacaa |
20526989 |
T |
|
| Q |
119 |
caatatgctcactgtaaaagagtagagtgtatatgcgctcgaaatagccaaatgctaagttgcaacaaattttcaaaatggtcaaggaaaacaagttaaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
20526990 |
caatatgctcactgtaaaagagtagagtgtatatgcgctcgaaatagccaaatgctaagttgcaacaaattttcaaaatggtcaagggaaacaagttaaa |
20527089 |
T |
|
| Q |
219 |
aagaacaaat |
228 |
Q |
| |
|
|||||||||| |
|
|
| T |
20527090 |
aagaacaaat |
20527099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 108 times since January 2019
Visitors: 3674