View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0559_low_34 (Length: 274)
Name: NF0559_low_34
Description: NF0559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0559_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 16 - 245
Target Start/End: Complemental strand, 32272486 - 32272258
Alignment:
| Q |
16 |
acatcggatgataaagataatataatttaaaactcgcaaaccttataaacatgttgtgtctgtgtctagatccgtgtcaagaaacatttcgcttttataa |
115 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32272486 |
acatcggatgagaaagataatataatttaaaacttgcaaaccttataaacatgttgtgtctgtgtctagatccgtgtcaagaaacatttcgcttttataa |
32272387 |
T |
 |
| Q |
116 |
attatattattttcatgttcattaaattattcaattttggtcttaaccaataataagcatttcaaagtaatatacattgtttatatgtatgaattatttt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32272386 |
attatattattttcatgttca-taaattattcaattttggtcttaaccaataataagcatttcaaagtaatatacattgtttatatgtatgaattatttt |
32272288 |
T |
 |
| Q |
216 |
gattttgatcttcatgtcacacagtgaagg |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32272287 |
gattttgatcttcatgtcacacagtgaagg |
32272258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University