View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0559_low_38 (Length: 262)
Name: NF0559_low_38
Description: NF0559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0559_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 26 - 216
Target Start/End: Complemental strand, 55696166 - 55695975
Alignment:
Q |
26 |
ttgaggcaataatgtagagatcttaatcagtgatcttgaccattgataatatggagatcaatggttaagatcacctcattatttcctcaagnnnnnnnnn |
125 |
Q |
|
|
|||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
55696166 |
ttgaggaaataatgtagagatcttaatcactgatcttgaccattgataatatggagatcaatggttaagatctcctcattatttcctcaagtttttttt- |
55696068 |
T |
 |
Q |
126 |
cccaattgagagaatccatttccctagtttctatgggat--ccctatgaatttcaaatttcagtcagtaaatagtgttttagagattgtgatg |
216 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
55696067 |
cccaattgagagaatccatttccctagtttctatgggatatccctatgaatttcaaatttcagtcagtaaatagtgttttagagattgtgatg |
55695975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 57 - 98
Target Start/End: Original strand, 7898163 - 7898204
Alignment:
Q |
57 |
gatcttgaccattgataatatggagatcaatggttaagatca |
98 |
Q |
|
|
||||||||||||||||||| |||||||||||||| ||||||| |
|
|
T |
7898163 |
gatcttgaccattgataatgtggagatcaatggtcaagatca |
7898204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 65 - 97
Target Start/End: Original strand, 26919500 - 26919532
Alignment:
Q |
65 |
ccattgataatatggagatcaatggttaagatc |
97 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
26919500 |
ccattgataatatggagatcaatggttaagatc |
26919532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University