View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0559_low_41 (Length: 252)

Name: NF0559_low_41
Description: NF0559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0559_low_41
NF0559_low_41
[»] chr3 (4 HSPs)
chr3 (11-252)||(47424478-47424719)
chr3 (11-121)||(47391042-47391152)
chr3 (11-121)||(47419405-47419515)
chr3 (11-125)||(47421873-47421987)


Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 11 - 252
Target Start/End: Complemental strand, 47424719 - 47424478
Alignment:
11 gagatgaagtacccaaacatcaatttgtactgcttatgaaaggcattgtggggaagcagatgcttatatcggcattaacagaagtgcaacaacaggtacg 110  Q
    ||||||||||  |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||  |||||||||||||||| |||||||||||    
47424719 gagatgaagtgtccaaacatcaatttgtacggcttatgaaaggcattgtggggaagcagatgcttatatcaacattaacagaagtgcaccaacaggtacg 47424620  T
111 tagattagatggtttctgcagtgttgtagatgatttttcgtaaggtcgctgaaaattgatttcaaggttatgctaagaataatccttttttcttctagag 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
47424619 tagattagatggtttctgcagtgttgtagatgatttttcgtaaggtcgttgaaaattgatttcaaggttatgctaagaataatccttttttcttctagag 47424520  T
211 aagaggcaacctaggttcagcagcaactgttcgcgagataac 252  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
47424519 aagaggcaacctaggttcagcagcaactgttcgagagataac 47424478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 11 - 121
Target Start/End: Complemental strand, 47391152 - 47391042
Alignment:
11 gagatgaagtacccaaacatcaatttgtactgcttatgaaaggcattgtggggaagcagatgcttatatcggcattaacagaagtgcaacaacaggtacg 110  Q
    |||||||| |||| ||| | || ||||||| |||||||||||| ||||||||| | ||||||||||     ||||||||| ||||||||||||||||| |    
47391152 gagatgaaatacctaaagaacattttgtacggcttatgaaagggattgtgggggatcagatgcttaggatagcattaacaaaagtgcaacaacaggtagg 47391053  T
111 tagattagatg 121  Q
     ||| ||||||    
47391052 cagaatagatg 47391042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 11 - 121
Target Start/End: Complemental strand, 47419515 - 47419405
Alignment:
11 gagatgaagtacccaaacatcaatttgtactgcttatgaaaggcattgtggggaagcagatgcttatatcggcattaacagaagtgcaacaacaggtacg 110  Q
    |||||||| | |||||| | || ||||||| |||||||||||| ||||||||| | ||||||||||     |||||| || ||||||||||||||||| |    
47419515 gagatgaaatgcccaaagaacattttgtacggcttatgaaagggattgtgggggatcagatgcttaggatagcattagcaaaagtgcaacaacaggtagg 47419416  T
111 tagattagatg 121  Q
    |||| ||||||    
47419415 tagaatagatg 47419405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 11 - 125
Target Start/End: Complemental strand, 47421987 - 47421873
Alignment:
11 gagatgaagtacccaaacatcaatttgtactgcttatgaaaggcattgtggggaagcagatgcttatatcggcattaacagaagtgcaacaacaggtacg 110  Q
    |||||||| |||| ||| | || ||||||| |||||||||||| ||||||||| | | ||||||||     |||||| || ||||||||||||||||| |    
47421987 gagatgaaataccgaaagaacattttgtacggcttatgaaagggattgtgggggatccgatgcttaggatagcattagcaaaagtgcaacaacaggtagg 47421888  T
111 tagattagatggttt 125  Q
    |||| ||||| ||||    
47421887 tagaatagatagttt 47421873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1159 times since January 2019
Visitors: 3663