View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0559_low_42 (Length: 251)
Name: NF0559_low_42
Description: NF0559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0559_low_42 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 10 - 251
Target Start/End: Original strand, 44703764 - 44704005
Alignment:
| Q |
10 |
gcagagatctagagtagtggatccaactccccttcgtgagggacactccaaagattagtaggttaaattaaattaaacaaaacccagagtaatttattct |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44703764 |
gcagagatctagagtagtggatccaactccccttcgtgagggacactccaaagattagtaggttaaattaaattaaacaaaacccagagtaatttattct |
44703863 |
T |
|
| Q |
110 |
tctgtagtagggtgtaccgtaggctccgcagttgcatcatcaccaattgaaccatcaccgttgatttgatcaaggacgagaacgaatcccatagcaaagg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44703864 |
tctgtagtagggtgtaccgtaggctccgcagttgcatcatcaccaattgaaccatcaccgttgatttgatcaaggacgagaacgaatcccatagcaaagg |
44703963 |
T |
|
| Q |
210 |
cagcgtcaaaaccaggcttaacacaaagagataacacttctt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44703964 |
cagcgtcaaaaccaggcttaacacaaagagataacacttctt |
44704005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 107 - 249
Target Start/End: Original strand, 44714564 - 44714706
Alignment:
| Q |
107 |
tcttctgtagtagggtgtaccgtaggctccgcagttgcatcatcaccaattgaaccatcaccgttgatttgatcaaggacgagaacgaatcccatagcaa |
206 |
Q |
| |
|
|||||||| ||||| || || | || ||||||||||||||||||| ||| ||| |||||||| |||| |||||||||||||||| |||||||| |||| |
|
|
| T |
44714564 |
tcttctgtggtaggatgcacagaagactccgcagttgcatcatcatcaagggaatcatcaccgctgatatgatcaaggacgagaataaatcccattgcaa |
44714663 |
T |
|
| Q |
207 |
aggcagcgtcaaaaccaggcttaacacaaagagataacacttc |
249 |
Q |
| |
|
| ||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
44714664 |
aagcagcatcaaaaccaggcttaacacaaagagagaacacttc |
44714706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 82 times since January 2019
Visitors: 3673