View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0559_low_43 (Length: 251)
Name: NF0559_low_43
Description: NF0559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0559_low_43 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 9 - 251
Target Start/End: Complemental strand, 32272683 - 32272443
Alignment:
| Q |
9 |
agcacagatccttttgttaaattaaaaaatcatactattcagcattgcatagatactgacatattgttacttttataaataatagtgttattagtacata |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32272683 |
agcacagatccttttgttaaattaaaaaatcatactattcagcattgcatagatactgacatattgttacttttataaataa--gtgttattagtacata |
32272586 |
T |
 |
| Q |
109 |
tgatttccgacaccgtatcttgacaccatataacattgagtgtgatcttgtcaaaagaaaacatttagtatgaacaatggtcccgaggagagagaacaaa |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32272585 |
tgatttccgacaccgtatcttgacaccatataacattgagtgtgatcttgtcaaaagaaaacattgagtatgaacaatggtcccgaggagagagaacaaa |
32272486 |
T |
 |
| Q |
209 |
catcggatgataaagataatataatttaaaactcgcaaacctt |
251 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
32272485 |
catcggatgagaaagataatataatttaaaacttgcaaacctt |
32272443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University