View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0559_low_44 (Length: 251)
Name: NF0559_low_44
Description: NF0559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0559_low_44 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 5 - 242
Target Start/End: Original strand, 51436651 - 51436889
Alignment:
| Q |
5 |
caactcttaaatagtaaatctgttttcaaacacttaccgttcggaatgaagcaatcatcgaaatttttcttacaaaaacccttcatcgtaccaattttct |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51436651 |
caactcttaaatagtaaatctgttttcaaacacttaccgttcggaatgaagcaatcatcaaaatttttcttacaaaaacccttcatcgtaccaattttct |
51436750 |
T |
|
| Q |
105 |
taacaaatgtagaatcgtacgagtttagaaaa-gattttaacaatccacaaaagtccgatttagaattaatgcccgaaattttgtgctagctcaagataa |
203 |
Q |
| |
|
||||||||||||||||||||||||| |||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
51436751 |
taacaaatgtagaatcgtacgagttcagaaaaggtttttaacaatccacaaaagtccgatttagaattaatgcccgaaattttatgctagctcaagataa |
51436850 |
T |
|
| Q |
204 |
acaaaatacgaagaagaatatgaacattgatagaataat |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51436851 |
acaaaatacgaagaagaatatgaacattgatagaataat |
51436889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1803 times since January 2019
Visitors: 3673