View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0563_low_4 (Length: 338)

Name: NF0563_low_4
Description: NF0563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0563_low_4
NF0563_low_4
[»] chr5 (1 HSPs)
chr5 (93-236)||(27577963-27578103)


Alignment Details
Target: chr5 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 93 - 236
Target Start/End: Original strand, 27577963 - 27578103
Alignment:
93 attacgtcgatcagtctccaaaatcagtcactacaaaatttatagaattggtcactaaaatgcattaaacttgtttctaactacacatttgtgaataaaa 192  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| | |||||||||||||| |||||||||   |    
27577963 attacgtcgatcaatctccaaaatcagtcactacaaaatttatagaattggtcactaaaatgcactaaattggtttctaactacacgtttgtgaat---a 27578059  T
193 atggtttaccactatatcacttcaagaaacaaggtacgtatatc 236  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
27578060 atggtttaccactatatcacttcaagaaacaaggtacgtatatc 27578103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University