View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0563_low_8 (Length: 209)
Name: NF0563_low_8
Description: NF0563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0563_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 62 - 197
Target Start/End: Original strand, 6062587 - 6062722
Alignment:
| Q |
62 |
caacttcagcaccatcaaaagtccaactattcttaaaacgaatcgccgcctcttcctccgccgtaagatcattctcgataccaaaatagtttctcacata |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6062587 |
caacttcagcaccatcaaaagtccaactattcttaaaacgaatcgccgcctcttcctccgccgtaagatcattctcgataccaaaatagtttctcacata |
6062686 |
T |
|
| Q |
162 |
cacaacattcttattcttgatccgatccgcaacagc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
6062687 |
cacaacattcttattcttgatccgatccgcaacagc |
6062722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1181 times since January 2019
Visitors: 3642