View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0565_low_5 (Length: 247)
Name: NF0565_low_5
Description: NF0565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0565_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 21 - 207
Target Start/End: Original strand, 32185217 - 32185403
Alignment:
| Q |
21 |
actattctaattttgtacccactaatactgaagaatatcaacaaatgctatagttaatttacttgtctcttctatatgatgttacacccataacaagcag |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32185217 |
actattctaattttgtacccactaatactgaagaatatcaacaaatgctatagttaatttacttgtctcttctatatgatgttacacccataacaagcag |
32185316 |
T |
 |
| Q |
121 |
tgaaattctctcatttaannnnnnnggattactttaaattttggagattcattcgagcactaaattttagttttatttgagaataat |
207 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32185317 |
tgaaattctctcaattaatttttttggattactttaaattttggagattcattcgagcactaaattttagttttatttgagaataat |
32185403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University