View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0566_high_4 (Length: 251)
Name: NF0566_high_4
Description: NF0566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0566_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 33 - 196
Target Start/End: Complemental strand, 14962443 - 14962281
Alignment:
| Q |
33 |
ttctttactttgtcccatgacatgaacatttcaagagctccaatatcattgaaatgcatcatgaaaaaagaaattgtatggaccacacacgtctttacga |
132 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
14962443 |
ttctttactttggcccatgacatgaacatttcaagagctccaatatcattgaaatgcatcatgaaaaaagaaattgtatggaccacacacgtctttatga |
14962344 |
T |
 |
| Q |
133 |
accaagacaatatacaattgggaaccataatgtattatgaaaaatttatcaaaccattattaac |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
14962343 |
accaagacaatatacaattgggaaccataatgtattatgaaaaatttatcaaa-cattattaac |
14962281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University