View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0566_low_5 (Length: 311)

Name: NF0566_low_5
Description: NF0566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0566_low_5
NF0566_low_5
[»] chr8 (1 HSPs)
chr8 (62-221)||(35638832-35638991)


Alignment Details
Target: chr8 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 62 - 221
Target Start/End: Complemental strand, 35638991 - 35638832
Alignment:
62 taatacttaaatattaatgtgatgaattggaaaacatctgggcaaatgggagcaatagttattagttgcatccaacatgaaattttctcgaacatccaaa 161  Q
    ||||| |||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35638991 taataattaaatattaatgtgatgaattggaaaatatttgggcaaatgggagcaatagttattagttgcatccaacatgaaattttctcgaacatccaaa 35638892  T
162 atgaaaatagcaccagccactagctgattctatttcattttcgaacaccaggctacatcc 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35638891 atgaaaatagcaccagccactagctgattctatttcattttcgaacaccaggctacatcc 35638832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University