View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0566_low_5 (Length: 311)
Name: NF0566_low_5
Description: NF0566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0566_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 62 - 221
Target Start/End: Complemental strand, 35638991 - 35638832
Alignment:
Q |
62 |
taatacttaaatattaatgtgatgaattggaaaacatctgggcaaatgggagcaatagttattagttgcatccaacatgaaattttctcgaacatccaaa |
161 |
Q |
|
|
||||| |||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35638991 |
taataattaaatattaatgtgatgaattggaaaatatttgggcaaatgggagcaatagttattagttgcatccaacatgaaattttctcgaacatccaaa |
35638892 |
T |
 |
Q |
162 |
atgaaaatagcaccagccactagctgattctatttcattttcgaacaccaggctacatcc |
221 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35638891 |
atgaaaatagcaccagccactagctgattctatttcattttcgaacaccaggctacatcc |
35638832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University