View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0566_low_6 (Length: 288)
Name: NF0566_low_6
Description: NF0566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0566_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 141 - 267
Target Start/End: Original strand, 56311922 - 56312048
Alignment:
| Q |
141 |
cacgagcatgacgtggttatgccagggtttcgtttccatccaactgaagaagaacttgtagagttctaccttcgccgtaaggtcgagggaaaacgtttca |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56311922 |
cacgagcatgacgtggttatgccagggtttcgtttccatccaactgaagaagaacttgtagagttctaccttcgccgtaaggtcgagggaaaacgtttca |
56312021 |
T |
|
| Q |
241 |
acgttgagcttattacttttctcgatc |
267 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
56312022 |
acgttgagcttattacttttctcgatc |
56312048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 21 - 119
Target Start/End: Original strand, 56311796 - 56311894
Alignment:
| Q |
21 |
acatcatcacctaacatgagcagcatgagcttgagtcacgaagatggaacttctaacgataatattaacaaaggagctacagctacagttacagtagta |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56311796 |
acatcatcacctaacatgagcagcatgagcttgagtcacgaagatggaacttctaacgataatattaacaaaggagctacagctacagttacagtagta |
56311894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 199
Target Start/End: Original strand, 8449724 - 8449761
Alignment:
| Q |
162 |
ccagggtttcgtttccatccaactgaagaagaacttgt |
199 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
8449724 |
ccagggtttcgtttccacccaactgatgaagaacttgt |
8449761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1689 times since January 2019
Visitors: 3672