View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0568_high_19 (Length: 285)
Name: NF0568_high_19
Description: NF0568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0568_high_19 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 33 - 285
Target Start/End: Original strand, 763128 - 763380
Alignment:
Q |
33 |
gtctcatgataaaatgtaccctaaagcttgtttcaaaacctatgcttccgcctcttgaggacttgattggctaaaaatccaaatagtttgcgtacgtata |
132 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
763128 |
gtctcatgataaaatgtaccctaaagcttgtttcaaaacccatgcttccgcctcttgaggacttggttggctaaaaatccaaatagtttgcgtacgtata |
763227 |
T |
 |
Q |
133 |
aaattgcccttgtcgtctctaacacacatgtcgacgctgaatctgttctaatatgtaaaaatagtcacatcatcaacgtttcatttgagttccctagtgt |
232 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
763228 |
aaattgcccttgtcgtctctaacacacatgtcgacgctgaatctgttctaatatgtaaaaataatcacatcatcaacgtttcatttgagttccctagtgt |
763327 |
T |
 |
Q |
233 |
cgaaacaacccaccacgttgttgtcgttccctttcctacttactacgttcgat |
285 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
T |
763328 |
cgaaacaacccaccatgttgttgtcgttccctttcctgcttactacgttcgat |
763380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 141 times since January 2019
Visitors: 3831