View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0568_high_20 (Length: 283)
Name: NF0568_high_20
Description: NF0568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0568_high_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 5e-96; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 46 - 239
Target Start/End: Complemental strand, 42522400 - 42522207
Alignment:
Q |
46 |
attatactccatctttcacttattaggcgtctcgtttaaaatatatttctgtcttatataatattattttataatatcagtacctcctgttgaaactgtg |
145 |
Q |
|
|
|||||||||||||| ||||||||||||| ||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42522400 |
attatactccatctgtcacttattaggcatcttgtttaaaatatatttctgtcttatattatattattttataatatcagtacctcctgttgaaactgtg |
42522301 |
T |
 |
Q |
146 |
agcgtccttgagccgcatcaggttttaacacttttatagcaactgcggtgtgatctagttcggccctatagactggtccataacctccttcacc |
239 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42522300 |
agcgtccttgagccgcatcaggttttaacacttttatagcaactgcggtgtgatctagttcggccctatagactggtccataacctccttcacc |
42522207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 47 - 239
Target Start/End: Complemental strand, 42530611 - 42530421
Alignment:
Q |
47 |
ttatactccatctttcacttattaggcgtctcgtttaaaatatatttctgtcttatataatattattttataatatcagtacctcctgttgaaactgtga |
146 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||| || |||||||||| || | |||||||||||||||||||||||||||||||||||| |
|
|
T |
42530611 |
ttatactccatctgtcacttattaggcgtctcgtttaaaatat--ttgtgtcttatattatgtcattttataatatcagtacctcctgttgaaactgtga |
42530514 |
T |
 |
Q |
147 |
gcgtccttgagccgcatcaggttttaacacttttatagcaactgcggtgtgatctagttcggccctatagactggtccataacctccttcacc |
239 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42530513 |
gcgtccttgagccgcatcaggttttaacacttttatagcaactgcggtgtgatctagttcggccctatagactggtccataacctccttcacc |
42530421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University