View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0568_high_28 (Length: 260)

Name: NF0568_high_28
Description: NF0568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0568_high_28
NF0568_high_28
[»] chr6 (3 HSPs)
chr6 (84-195)||(18366544-18366655)
chr6 (84-195)||(18371808-18371919)
chr6 (84-195)||(18376098-18376209)
[»] chr8 (1 HSPs)
chr8 (86-195)||(2975928-2976037)
[»] chr7 (2 HSPs)
chr7 (1-57)||(12630992-12631048)
chr7 (1-57)||(18852006-18852062)
[»] chr3 (2 HSPs)
chr3 (1-57)||(50880330-50880386)
chr3 (19-57)||(11348101-11348139)


Alignment Details
Target: chr6 (Bit Score: 92; Significance: 9e-45; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 84 - 195
Target Start/End: Original strand, 18366544 - 18366655
Alignment:
84 gtaagtgaaacataaattgtgggaatattgacaacatgggagacaaactaaatgaagatggggtttctttttgaaaatctctgaaacaggaacacaaatt 183  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||    
18366544 gtaagtgaaacataaattgtgggaatattgacaacctgggagacaaactaaatgaagatggggtttctttttgaaaatctccgagacaggaacacaaatt 18366643  T
184 gatcagtgcctt 195  Q
     |||| ||||||    
18366644 tatcaatgcctt 18366655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 84 - 195
Target Start/End: Original strand, 18371808 - 18371919
Alignment:
84 gtaagtgaaacataaattgtgggaatattgacaacatgggagacaaactaaatgaagatggggtttctttttgaaaatctctgaaacaggaacacaaatt 183  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||    
18371808 gtaagtgaaacataaattgtgggaatattgacaacctgggagacaaactaaatgaagatggggtttctttttgaaaatctccgagacaggaacacaaatt 18371907  T
184 gatcagtgcctt 195  Q
     |||| ||||||    
18371908 tatcaatgcctt 18371919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 84 - 195
Target Start/End: Original strand, 18376098 - 18376209
Alignment:
84 gtaagtgaaacataaattgtgggaatattgacaacatgggagacaaactaaatgaagatggggtttctttttgaaaatctctgaaacaggaacacaaatt 183  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||    
18376098 gtaagtgaaacataaattgtgggaatattgacaacctgggagacaaactaaatgaagatggggtttctttttgaaaatctccgagacaggaacacaaatt 18376197  T
184 gatcagtgcctt 195  Q
     |||| ||||||    
18376198 tatcaatgcctt 18376209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 86 - 195
Target Start/End: Complemental strand, 2976037 - 2975928
Alignment:
86 aagtgaaacataaattgtgggaatattgacaacatgggagacaaactaaatgaagatggggtttctttttgaaaatctctgaaacaggaacacaaattga 185  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |    
2976037 aagtgaaacataaattgtgggaatattgacaacctgggagacaaactaaatgaagatggggtttctttttgaaaatctccgaaacgggaacacaaattta 2975938  T
186 tcagtgcctt 195  Q
    ||| ||||||    
2975937 tcaatgcctt 2975928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 12630992 - 12631048
Alignment:
1 catcccccaaatcttctcacctaattatcttctcctgttcctttcatctcaaacacc 57  Q
    |||||||||||||||||||||||||| || |||||| ||||||||||||||||||||    
12630992 catcccccaaatcttctcacctaattctcctctcctattcctttcatctcaaacacc 12631048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 18852062 - 18852006
Alignment:
1 catcccccaaatcttctcacctaattatcttctcctgttcctttcatctcaaacacc 57  Q
    ||||||||||||||||||||||||||  |||||  ||||||||||||||||||||||    
18852062 catcccccaaatcttctcacctaattcccttctattgttcctttcatctcaaacacc 18852006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 50880330 - 50880386
Alignment:
1 catcccccaaatcttctcacctaattatcttctcctgttcctttcatctcaaacacc 57  Q
    |||||||||||| ||||||||||||| ||||||| ||||||||||||||||||||||    
50880330 catcccccaaatattctcacctaattctcttctcttgttcctttcatctcaaacacc 50880386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 57
Target Start/End: Complemental strand, 11348139 - 11348101
Alignment:
19 acctaattatcttctcctgttcctttcatctcaaacacc 57  Q
    |||||||| ||||||| ||||||||||||||||||||||    
11348139 acctaattctcttctcttgttcctttcatctcaaacacc 11348101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University