View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0568_high_37 (Length: 235)
Name: NF0568_high_37
Description: NF0568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0568_high_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 34437312 - 34437083
Alignment:
Q |
1 |
tccgatgtgactcataggataatactgtgatattgcagttgagtttgaatagctctggagcagtagcttcagttccaaattcatcattctttggaaccag |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
34437312 |
tccgatgtgactcataggataatactgtgatattgcagttgagtttgaatagctctggagcagtagcttcagttccaagttcatcattctttggaaccag |
34437213 |
T |
 |
Q |
101 |
cttaaagaaagttacctcgaggttaccaaacacaaaggtttcatctggaagattcaaaattgttgctgctgagattgatgaaagcaagcaaactgacaaa |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
34437212 |
cttaaagaaagttacctcgaggttaccaaacacaaaggtttcatctggaagattcaaaattgttgctgctgagattaatgaaagcaagcaaactgacaaa |
34437113 |
T |
 |
Q |
201 |
gacaaatggagaggtttggcctatgatact |
230 |
Q |
|
|
|||| ||||||||||||||||||||||||| |
|
|
T |
34437112 |
gacagatggagaggtttggcctatgatact |
34437083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2728 times since January 2019
Visitors: 3823