View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0568_high_7 (Length: 410)
Name: NF0568_high_7
Description: NF0568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0568_high_7 |
 |  |
|
[»] scaffold0154 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0154 (Bit Score: 252; Significance: 1e-140; HSPs: 2)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 21 - 295
Target Start/End: Complemental strand, 22736 - 22468
Alignment:
Q |
21 |
gaatcatgaacaattcgtaatggagcaccatttaaatatgttctaggatcttatgaagatggaaagaaaagaatcgactattaccaaactcactcacaca |
120 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22736 |
gaatcatgaacaattcgtaatggagcaccatttaaatatgttctaggatcttatgaagatggaaagaaaagaatcgactattaccaaactcactcacaca |
22637 |
T |
 |
Q |
121 |
aatgaaatcattgtggaattttggcaacgtaagagtgagatcaaagtattctagagtttattcacttgggaaaggcataggtataagattactataacaa |
220 |
Q |
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22636 |
a------tcattgtggaattttggcaacgtaagagtgagatcaaagtattctagagtttattcacttgggaaaggcataggtataagattactataacaa |
22543 |
T |
 |
Q |
221 |
gatttaaattaagaggggaaaccgcgtttggtatgaattatacaaagcatgagaaaagaaaagatggtgtaggtg |
295 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22542 |
gatttaaattaagaggggaaaccgcgtttggtatgaattatacaaagcatgagaaaagaaaagatggtgtaggtg |
22468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 76 - 175
Target Start/End: Complemental strand, 12839 - 12745
Alignment:
Q |
76 |
aagatggaaagaaaagaatcgactattaccaaactcactcacacaaatgaaatcattgtggaattttggcaacgtaagagtgagatcaaagtattctaga |
175 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
12839 |
aagatggaaagaaaagaatcgaccattaccaaactcactcaaacaaag-----cattgtggaattttggcaacgtaggagtgagatcaaagtattctaga |
12745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2931 times since January 2019
Visitors: 3831