View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0568_low_21 (Length: 385)
Name: NF0568_low_21
Description: NF0568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0568_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 7 - 87
Target Start/End: Complemental strand, 8059434 - 8059354
Alignment:
| Q |
7 |
tccaacaatataaaaaacaatagttgatttaagtgcgtcgaacaagactcaaacagttcaaccatcaacgaaatcataacc |
87 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8059434 |
tccaataatataaaaaacaatagttgatttaagtgcgtcgaacaagactcaaacagttcaaccatcaacgaaatcacaacc |
8059354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University