View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0568_low_57 (Length: 234)

Name: NF0568_low_57
Description: NF0568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0568_low_57
NF0568_low_57
[»] chr5 (1 HSPs)
chr5 (1-205)||(34437288-34437479)


Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 34437288 - 34437479
Alignment:
1 gtattatcctatgagtcacatcggacatgacactaatacgtagacattggtaatcatttaagaaaattaaattattgaatgtaagtcaacacatgtgtcg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34437288 gtattatcctatgagtcacatcggacatgacactaatacgtagacattggtaatcatttaagaaaattaaattattgaatgtaagtcaacacatgtgtcg 34437387  T
101 gtagcatgttggtgtatgagacaaatacatgttagacactagacacgactttaatctaaagtatcagttctacttaggaattagccactcttttgtacta 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||             |||||||||||||||||||||||||||||||||||||||||    
34437388 gtagcatgttggtgtatgagacaaatacatgttagacactagacac-------------agtatcagttctacttaggaattagccactcttttgtacta 34437474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University