View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0568_low_57 (Length: 234)
Name: NF0568_low_57
Description: NF0568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0568_low_57 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 34437288 - 34437479
Alignment:
| Q |
1 |
gtattatcctatgagtcacatcggacatgacactaatacgtagacattggtaatcatttaagaaaattaaattattgaatgtaagtcaacacatgtgtcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34437288 |
gtattatcctatgagtcacatcggacatgacactaatacgtagacattggtaatcatttaagaaaattaaattattgaatgtaagtcaacacatgtgtcg |
34437387 |
T |
 |
| Q |
101 |
gtagcatgttggtgtatgagacaaatacatgttagacactagacacgactttaatctaaagtatcagttctacttaggaattagccactcttttgtacta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34437388 |
gtagcatgttggtgtatgagacaaatacatgttagacactagacac-------------agtatcagttctacttaggaattagccactcttttgtacta |
34437474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University