View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0568_low_60 (Length: 207)
Name: NF0568_low_60
Description: NF0568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0568_low_60 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 10 - 165
Target Start/End: Original strand, 4918618 - 4918773
Alignment:
| Q |
10 |
aagttgaccggtatctcgttagtgacttagagcgatatcataagagatatttaggtcaaaatgttaatgtatctggttctcggctgcttgaggattgaaa |
109 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
4918618 |
aagttgaccggtagctcgtcagtgacttagagcgatatcataagagatatttaggtcaaaatgttaatgtatctggttctcggctgcttgaggattggaa |
4918717 |
T |
|
| Q |
110 |
ttatgtgtgctgtgtctgtgtatttctgttctggtagcttgttttcggcctttgct |
165 |
Q |
| |
|
|||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4918718 |
ttatatgcgctgtgtctgtgtatttctgttctggtagcttgttttcggcctttgct |
4918773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 81
Target Start/End: Original strand, 4918515 - 4918553
Alignment:
| Q |
43 |
gatatcataagagatatttaggtcaaaatgttaatgtat |
81 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
4918515 |
gatattataagagatatgtaggtcaaaatgttaatgtat |
4918553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2950 times since January 2019
Visitors: 3831