View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0570_high_16 (Length: 267)
Name: NF0570_high_16
Description: NF0570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0570_high_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 141 - 238
Target Start/End: Original strand, 37630206 - 37630305
Alignment:
| Q |
141 |
tttcaaac-gcttgcagatacggtgtatgca-aaaacaaaaatggataaaagttgtatgtttgcattggagatctatatgttgcattcaccacatctcat |
238 |
Q |
| |
|
|||||||| ||||||| ||| |||||||||| |||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37630206 |
tttcaaacagcttgcatatatggtgtatgcacaaaataaaaatggataaaagttgtatgtttgcgttggagatctatatgttgcattcaccacatctcat |
37630305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 970 times since January 2019
Visitors: 3838