View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0570_low_19 (Length: 324)
Name: NF0570_low_19
Description: NF0570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0570_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 8e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 2606959 - 2606731
Alignment:
| Q |
1 |
catctttcgattctcttaactcttgtgatgccaaatttccttcacttcaattctgtagtattgtttgtatcgccctcttatctataagacnnnnnnn-at |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| || |
|
|
| T |
2606959 |
catctttcgattctcttaactcttgtgatgccaaatttccttcacttcaattctctagtattgtttgtatcgccctcttatctataagacttttttttat |
2606860 |
T |
 |
| Q |
100 |
attctaattaaacaactttctgcttatgatgatattgatatatattgacgtaaaaggatcaagttcagcacggaaaaaatatattattgagcaagttgtt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2606859 |
attctaattaaacaactttctgcttatgatgatgt------atattgacgtaaaaggatcaagttcagcacggaaaaaatatattattgagcaagttgtt |
2606766 |
T |
 |
| Q |
200 |
caatgtgattttcaacggattttgtatgaccggct |
234 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
2606765 |
caatgtgattttcaacggattttgtaagaccggct |
2606731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University