View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0570_low_22 (Length: 273)
Name: NF0570_low_22
Description: NF0570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0570_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 51 - 130
Target Start/End: Original strand, 28387887 - 28387966
Alignment:
| Q |
51 |
cagtaaggcaaattgacagtaagggtttgagtttatttaattgagagaagtgggttgatagatggtggtgatattgttgg |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28387887 |
cagtaaggcaaattgacagtaagggtttgagtttatttaattgagagaagtgggttgatagatggtggtgatgttgttgg |
28387966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 27 times since January 2019
Visitors: 3832