View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0570_low_24 (Length: 251)
Name: NF0570_low_24
Description: NF0570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0570_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 160
Target Start/End: Original strand, 31639244 - 31639403
Alignment:
| Q |
1 |
ccatgctgctgcctatagaagttaccaactacatttcaaggttccaagcacatcatatattcaacttataacaatnnnnnnnntattaccggcattgcat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31639244 |
ccatgctgctgcctatagaagttaccaactacatttcaaggttccaagcacatcatatattcaacttataacaataaaaaaaatattaccggcattgcat |
31639343 |
T |
 |
| Q |
101 |
tctttacattgtggtccgatgtgccaaattgaaccggttcaacgtggttggttcaatcag |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31639344 |
tctttacattgtggtccgatgtgccaaattgaaacggttcaacgtggttggttcaatcag |
31639403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 194 - 241
Target Start/End: Original strand, 31639437 - 31639484
Alignment:
| Q |
194 |
gtcatctgactctgccgagagatgaaggtcttaccggttcaatctctg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31639437 |
gtcatctgactctgccgagagatgaaggtcttaccggttcaatctctg |
31639484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University