View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0570_low_26 (Length: 242)
Name: NF0570_low_26
Description: NF0570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0570_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 37 - 109
Target Start/End: Original strand, 20596300 - 20596372
Alignment:
Q |
37 |
gaagggttcatgtgagagtcagatgcactgtgtaaaaataccaggtgagaaaacatggcaattgaggaggata |
109 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
20596300 |
gaagggttcatgtgagagtcagatgcactgtgtaaaaataccaggtgaggaaacatggcaattgaggaggata |
20596372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 37 - 109
Target Start/End: Original strand, 8697301 - 8697373
Alignment:
Q |
37 |
gaagggttcatgtgagagtcagatgcactgtgtaaaaataccaggtgagaaaacatggcaattgaggaggata |
109 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
T |
8697301 |
gaagggttcatgtgagagtcaaatgcactgtgtaaaaataccagatgaggaaacatggcaattgaggaggata |
8697373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2284 times since January 2019
Visitors: 3818