View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0570_low_28 (Length: 228)
Name: NF0570_low_28
Description: NF0570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0570_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 1 - 95
Target Start/End: Original strand, 20596278 - 20596372
Alignment:
Q |
1 |
tgaaggtaatttatcgtgggaagaagggttcatgtgagagtcagatgcactgtgtaaaaataccaggtgagaaaacatggcaattgaggaggata |
95 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
20596278 |
tgaaggtaatttgtcgtgggaagaagggttcatgtgagagtcagatgcactgtgtaaaaataccaggtgaggaaacatggcaattgaggaggata |
20596372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 95
Target Start/End: Original strand, 8697279 - 8697373
Alignment:
Q |
1 |
tgaaggtaatttatcgtgggaagaagggttcatgtgagagtcagatgcactgtgtaaaaataccaggtgagaaaacatggcaattgaggaggata |
95 |
Q |
|
|
|||||||||| | |||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
T |
8697279 |
tgaaggtaatatgtcgtgggaagaagggttcatgtgagagtcaaatgcactgtgtaaaaataccagatgaggaaacatggcaattgaggaggata |
8697373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 208 times since January 2019
Visitors: 3833