View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0571-INSERTION-20 (Length: 256)
Name: NF0571-INSERTION-20
Description: NF0571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0571-INSERTION-20 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 127 - 256
Target Start/End: Complemental strand, 49124171 - 49124042
Alignment:
| Q |
127 |
ttatgaatattaaaatctatgttaacacacttaacatatttacattcttctttgatgaccagaggattagaatatctacatgagcattgttaccctcgag |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49124171 |
ttatgaatattaaaatctatgttaacacacttaacatatttacattcttctttgatgaccagaggattagaatatctacatgagcattgttaccctcgag |
49124072 |
T |
 |
| Q |
227 |
tgattcatagagatatgaaatcttcaaata |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
49124071 |
tgattcatagagatatgaaatcttcaaata |
49124042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 8 - 134
Target Start/End: Complemental strand, 49124350 - 49124225
Alignment:
| Q |
8 |
caagtatacaaaattcaaaattacaagctgttaacaaattaatgaacaattccgattggagaagttatagatcgttttcattctgcatcttaaaagtttt |
107 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49124350 |
caagtatacaaaattcaaaattacaa-ctgttaacaaattaatgaacaattccgattggagaagttatagatcgttttcattctgcatcttaaaagtttt |
49124252 |
T |
 |
| Q |
108 |
gtccccttaacaaagtttattatgaat |
134 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
49124251 |
gtccccttaacaaagtttattatgaat |
49124225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University