View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0571-INSERTION-5 (Length: 171)
Name: NF0571-INSERTION-5
Description: NF0571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0571-INSERTION-5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 144; Significance: 5e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 5e-76
Query Start/End: Original strand, 10 - 169
Target Start/End: Complemental strand, 41721760 - 41721602
Alignment:
| Q |
10 |
atgatgaaaacatactaattaattttgtgaaagattgtccaattgagttgtgcatttcatcctctactgaccaactttagaggtaattaaagcttcgttt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41721760 |
atgatgaaaacatactaattaattttgtgaaagatggtccaattgagttgtgcatttcatcctctactgac-aactttagaggtaattaaagcttcgttt |
41721662 |
T |
 |
| Q |
110 |
gaatctcacttgaacatatacgataccatgttgtaattttagacttgacgatggaatttt |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41721661 |
gaatctcacttgaacatatacgataccatgttgtagttttagacttgacgatggaatttt |
41721602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University