View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0571-INSERTION-9 (Length: 390)
Name: NF0571-INSERTION-9
Description: NF0571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0571-INSERTION-9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 8 - 331
Target Start/End: Original strand, 2777961 - 2778288
Alignment:
Q |
8 |
cgaagcacaattcaaaaacaacatcaaaattaagatcattggattaggtgcagtcgggacaggcgcaatcaagatgcggtcaacatctcagaaccgtgat |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2777961 |
cgaagcacaattcaaaaacaacatcaaaattaagatcattggattaggtgcagtcgggacaggcgcaatcaagatgcggtcaacatctcagaaccgtgat |
2778060 |
T |
 |
Q |
108 |
tttattttttcagatcattggtcatttgggg----gtttgtattcgctaaaaattgttttatttgttcaagtaatatggcgaaacactagtgaggagagg |
203 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2778061 |
tttattttttcagatcattggtcatttgggggtttgtttgtattcgctaaaaattgttttatttgttcaagtaatatggcgaaacactagtgaggagagg |
2778160 |
T |
 |
Q |
204 |
accctcnnnnnnnngtcaacattggtccattgagtcttcctcttcccttataatatgttgatgattgttttacatatgccccctgcattcccataaaatc |
303 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2778161 |
accctcttttttttgtcaacattggtccattgagtcttcctcttcccttataatatgttgatgattgttttacatatgccccctgcattcccataaaatc |
2778260 |
T |
 |
Q |
304 |
cccttaaaatatcacttaagataataag |
331 |
Q |
|
|
|||||||||||||||||||||||||||| |
|
|
T |
2778261 |
cccttaaaatatcacttaagataataag |
2778288 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University