View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0571_high_26 (Length: 251)
Name: NF0571_high_26
Description: NF0571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0571_high_26 |
| |
|
Alignment Details
Target: chr6 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 6894640 - 6894398
Alignment:
Q |
1 |
taaattaagtatgtgaattaagaacctggactgtgaaattgaagagcgacatcttcttttgtgaaactataagttgaagccattgcctttgtttgaattt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6894640 |
taaattaagtatgtgaattaagaacctggactatgaaattgaagagctacatcttcttttgtgaaactataagttgaagccattgcctttgtttgaattt |
6894541 |
T |
|
Q |
101 |
gtcttgctgaaaagactaaaggagctgacatggtgattttatttgttgttgagttttgaaataatcttccactaagagtttttgcagataaacattccat |
200 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6894540 |
gtcttgatgaaaagactaaaggagctgacatggtgattttatttgttgttgagttttgaaataatcttccactaagagtttttgcagataaacattccat |
6894441 |
T |
|
Q |
201 |
tggtacttcccctgaaagaggattgcatatatacttctctgct |
243 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6894440 |
tggtacttcccctgaaagaggattgcatatatacttctctgct |
6894398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 146 - 243
Target Start/End: Original strand, 5939379 - 5939476
Alignment:
Q |
146 |
ttgttgagttttgaaataatcttccactaagagtttttgcagataaacattccattggtacttcccctgaaagaggattgcatatatacttctctgct |
243 |
Q |
|
|
||||||||||| ||| |||||||||||||||||||||| ||||||||||||||||| || ||||||||||| |||||||||||||| || |||||| |
|
|
T |
5939379 |
ttgttgagtttctgaatgatcttccactaagagtttttgctgataaacattccattggcacctcccctgaaagtggattgcatatatatttttctgct |
5939476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3851 times since January 2019
Visitors: 5847