View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0571_high_3 (Length: 687)
Name: NF0571_high_3
Description: NF0571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0571_high_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 472; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 472; E-Value: 0
Query Start/End: Original strand, 11 - 506
Target Start/End: Complemental strand, 30995490 - 30994995
Alignment:
| Q |
11 |
cacagagtgatctgaatcaaatggctgctgtggcagacattgttgaccattttcaatggagagatgtgatagcaattttcatagatgatgatcatggaag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30995490 |
cacagagtgatctgaatcaaatggctgctgtggcagacattgttgaccattttcaatggagagatgtgatagcaattttcatagatgatgatcatggaag |
30995391 |
T |
|
| Q |
111 |
aaatgggatagctgcattaggtgataagctagcagagaaacatagtaaaatatcatataaagcagctcttagacctgatcaactcaccactgatgaaata |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30995390 |
aaatgggatagctgcattaggtgataagctagcagagaaacatagtaaaatatcatataaagcagctcttagacctgatcaactcaccactgatgaaata |
30995291 |
T |
|
| Q |
211 |
aacaatgctttatttaaagtagctttgatggagtctagagtaattgtccttcatgtaacccttcattttggtctacaagtacttcacttggctcaatcac |
310 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30995290 |
aacaatgcattatttaaggtagctttgatggagtctagagtaattgtccttcatgtaacccttcattttggtctacaagtacttcacttggctcaatcac |
30995191 |
T |
|
| Q |
311 |
atgaaatgatgggaagtggttatgcatggatagccactgattggctttctacgatactagattccgatccttcgttgtccacatctgcagcgatgaatga |
410 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
30995190 |
atgaaatgatgggaagtggttatgtatggatagccactgattggctttctacgatactagattccgatccttcgttgtccacatctgcaacaatgaatga |
30995091 |
T |
|
| Q |
411 |
catgcaaggtgttatcaccttgaggatgtacacaccagaatcaaaaaacaaaagaaatttcacttctagatggaacagaaacctgagccataacat |
506 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30995090 |
catgcaaggtgttatcaccttgaggatgtacacaccagaatcaaaaaataaaagaaatttcacttctagatggaacagaaacctgagccataacat |
30994995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 132 times since January 2019
Visitors: 3833