View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0571_low_21 (Length: 412)
Name: NF0571_low_21
Description: NF0571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0571_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 78 - 274
Target Start/End: Complemental strand, 8912747 - 8912551
Alignment:
Q |
78 |
cagagaaagaatatctaactttcctttctgggtttcgtcagttagcaccaaaagatgctgttttgaacaacttagcactttctgatgtgaatttgcaaga |
177 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8912747 |
cagagaaagaatatctaactttcctttctgggtttcgtcagttagcaccaaaagatgctgttttgaacaacttagcactttctgatgtgaatttgcaaga |
8912648 |
T |
 |
Q |
178 |
tataatcagtggtgctgataatgtgagttctgaagaagtgaaagatgaaaatggtcaagtttattatgtttatgagattgatggtgttgcttatcat |
274 |
Q |
|
|
||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8912647 |
tattattagtggtgctgataatgtgagttctgaagaagtgaaagatgaaaatggtcaagtttattatgtttatgagattgatggtgttgcttatcat |
8912551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1333 times since January 2019
Visitors: 3844