View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0571_low_25 (Length: 336)
Name: NF0571_low_25
Description: NF0571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0571_low_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 20 - 322
Target Start/End: Original strand, 2311071 - 2311383
Alignment:
Q |
20 |
acatcatcacttcacataattctacttttgacatgtcacaattttatgctccctacagcctcaagtatacaatacacagtagtgcacacactata--tag |
117 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
T |
2311071 |
acatgatcacttcacataattctacttttgacatgtcacaattttatgcttcctacagcctcaagtatacaatacacagtagtgcacacactatagatag |
2311170 |
T |
 |
Q |
118 |
acaaaaacctttaactgg--------agattgaagctcataattgtgtatattttatttataatctttccttctctatcttccttatgctatataagccc |
209 |
Q |
|
|
||| |||||||||||||| |||||||||||||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||||| |
|
|
T |
2311171 |
acacaaacctttaactggttacacaaagattgaagctcataattgtgtatatttgatttataatcatcccttctctatcttccttatgctatataagccc |
2311270 |
T |
 |
Q |
210 |
cacccccatcctctcttatcaattgaatcgtgactacaattccttcaacttctattataacacatagaattccttcaatttctactatgccactattgaa |
309 |
Q |
|
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
2311271 |
cacgcccatcctctcttatcaattgaatcgtgactacaattccttcaacttctattatatcacatagaattccttcaatttatactatgccactattgag |
2311370 |
T |
 |
Q |
310 |
accctctttgtcc |
322 |
Q |
|
|
|||||||||||| |
|
|
T |
2311371 |
gccctctttgtcc |
2311383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 165 times since January 2019
Visitors: 3831