View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0571_low_37 (Length: 212)

Name: NF0571_low_37
Description: NF0571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0571_low_37
NF0571_low_37
[»] chr1 (1 HSPs)
chr1 (124-210)||(10292627-10292716)


Alignment Details
Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 124 - 210
Target Start/End: Complemental strand, 10292716 - 10292627
Alignment:
124 gatgaatgcttgtggtttagtgcataataat---gatagaaagtttctgagaccactatctttgaattgtgactataagcaagtgcaagg 210  Q
    |||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10292716 gatgaatgcttgtggtttagtgcataataataatgatagaaagtttctgagaccactatctttgaattgtgactataagcaagtgcaagg 10292627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 74 times since January 2019
Visitors: 3831