View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0571_low_38 (Length: 208)
Name: NF0571_low_38
Description: NF0571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0571_low_38 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 1706992 - 1707115
Alignment:
Q |
1 |
tccaccattgtccatatcactaacgtaccattaaaatctatgaccttaatttaagaaaaatacaaaaaaccactgttcattccactattgtgcacaatac |
100 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| ||||| |
|
|
T |
1706992 |
tccaccattgtccatatcactgacgtaccattaaaatctatgaccttaatttaagaaaaatacaaaaaactactgttgattccactattgtgcataatac |
1707091 |
T |
 |
Q |
101 |
agcaagagtttacatcagtataat |
124 |
Q |
|
|
|||||||||||||||||||||||| |
|
|
T |
1707092 |
agcaagagtttacatcagtataat |
1707115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1476 times since January 2019
Visitors: 3846