View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0572_high_11 (Length: 396)
Name: NF0572_high_11
Description: NF0572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0572_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 1e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 131 - 315
Target Start/End: Complemental strand, 43329446 - 43329262
Alignment:
Q |
131 |
agctaggattatgaattggaccttggaaacaacaaggaaatgatcttaaccacatgcggggacgaacttcaaaattcaacactagcttgccttggatata |
230 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
43329446 |
agctaggattatgaattggaccttggaaacaacaaggaaatgatcttaaccacatgcggggaggaacttcaaaattcaacactagcttgccttggatata |
43329347 |
T |
 |
Q |
231 |
gaccttattattataaaaatgttattaagtgcataaggtggcactatatatcaatgtgattggttctcctttattgtctctgctc |
315 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43329346 |
gaccttattattataaaaatgttattaagtgcataaggtggcactatatatcaatgtgattggttctcctttattgtctctgctc |
43329262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1400 times since January 2019
Visitors: 3846