View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0572_high_21 (Length: 251)
Name: NF0572_high_21
Description: NF0572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0572_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 34 - 132
Target Start/End: Complemental strand, 34647882 - 34647782
Alignment:
Q |
34 |
gctatcctaccccaaaagaaaaatagtggtttggccggtgcttacgtggtttcacttgagtgcttgaagatt--gggcattgatgaaatttacgtatcga |
131 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
T |
34647882 |
gctatcctaccccaaaagaaaaatagtggtttggccggtgcttacgtggtttcacttgagtgcttgaagatttgtggcattgatgaaatttatgtatcga |
34647783 |
T |
 |
Q |
132 |
c |
132 |
Q |
|
|
| |
|
|
T |
34647782 |
c |
34647782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 202 - 251
Target Start/End: Complemental strand, 34647712 - 34647663
Alignment:
Q |
202 |
cactttacttgatttagtggtattgatttgagatttgtgagtatgttcct |
251 |
Q |
|
|
|||||| ||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
T |
34647712 |
cactttgcttgatttagtggtattgacttgagatctgtgagtatgttcct |
34647663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1370 times since January 2019
Visitors: 3846