View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0572_high_22 (Length: 251)

Name: NF0572_high_22
Description: NF0572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0572_high_22
NF0572_high_22
[»] chr7 (1 HSPs)
chr7 (74-228)||(34647382-34647536)


Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 74 - 228
Target Start/End: Original strand, 34647382 - 34647536
Alignment:
74 cgatggctacaattaagaggccctgtgtgactcgattgacacgagcataaccaacacaagtagtaacaaccggcaacaggacaatataatggacaccagg 173  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34647382 cgatggctacaattaagaggccctgtgtgactcgattgacacgagcataaccaacacaagtagtaacaaccggcaacaggacaatataatggacaccagg 34647481  T
174 ggaattttttggcacatcattcatacattgaagaattaatgatcttgcatttcta 228  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||| |||||    
34647482 ggaatttttgggcacatcattcatacattgaagaattaatgatcttgcaattcta 34647536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1453 times since January 2019
Visitors: 3846