View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0572_high_8 (Length: 413)
Name: NF0572_high_8
Description: NF0572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0572_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 373; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 373; E-Value: 0
Query Start/End: Original strand, 1 - 401
Target Start/End: Original strand, 6392892 - 6393292
Alignment:
Q |
1 |
aatgtcactggtgattaggtttctttatctgtgttttgagttatgtttctgtgttcttccttgctgacttttttgttcttcactcaacgttgttttcttt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
6392892 |
aatgtcactggtgattaggtttctttatctgtgttttgagttatgtttctgtgttcttccttgctgacttttctgttcttcactcaacgttgttttcttt |
6392991 |
T |
 |
Q |
101 |
tccatgtactgccagtacagtgaccttgctgaagatgaacgtgcttttgttttagacaaattttctcaagtggtgacgaggtggaatcaggttaatcata |
200 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6392992 |
tccatgtactgtcagtacagtgaccttgctgaagatgaacgtgcttttgttttagacaagttttctcaagtggtgacgaggtggaatcaggttaatcata |
6393091 |
T |
 |
Q |
201 |
ctggggaagggaatgaggatgatctcgggaaagatgatagatctcatatgattattgtcacagatgcttgtcttcctcttcttacttctggggagtctcc |
300 |
Q |
|
|
|||||||||||||||||||||||||| |||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6393092 |
ctggggaagggaatgaggatgatctcaggaaagatgatacatctcatatgattatcgtcacagatgcttgtcttcctcttcttacttctggggagtctcc |
6393191 |
T |
 |
Q |
301 |
catgaatgctcatcttctcattaactacgagttaccgacaaaaaaggtattctacttttcattttcttttctctaattcacatttaccttgcgactttct |
400 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6393192 |
catgaatgctcatcttctcattaactacgagttaccggcaaaaaaggtattctacttttcattttcttttctctaattcacatttaccttgcgactttct |
6393291 |
T |
 |
Q |
401 |
g |
401 |
Q |
|
|
| |
|
|
T |
6393292 |
g |
6393292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University