View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0572_low_12 (Length: 396)

Name: NF0572_low_12
Description: NF0572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0572_low_12
NF0572_low_12
[»] chr8 (1 HSPs)
chr8 (131-315)||(43329262-43329446)


Alignment Details
Target: chr8 (Bit Score: 181; Significance: 1e-97; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 131 - 315
Target Start/End: Complemental strand, 43329446 - 43329262
Alignment:
131 agctaggattatgaattggaccttggaaacaacaaggaaatgatcttaaccacatgcggggacgaacttcaaaattcaacactagcttgccttggatata 230  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
43329446 agctaggattatgaattggaccttggaaacaacaaggaaatgatcttaaccacatgcggggaggaacttcaaaattcaacactagcttgccttggatata 43329347  T
231 gaccttattattataaaaatgttattaagtgcataaggtggcactatatatcaatgtgattggttctcctttattgtctctgctc 315  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43329346 gaccttattattataaaaatgttattaagtgcataaggtggcactatatatcaatgtgattggttctcctttattgtctctgctc 43329262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University