View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0572_low_20 (Length: 294)
Name: NF0572_low_20
Description: NF0572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0572_low_20 |
 |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 272; Significance: 1e-152; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 284
Target Start/End: Complemental strand, 47544130 - 47543847
Alignment:
| Q |
1 |
ttgtctccattcatattaacctctccctgatcagctttctcttcgtctgaggatccacttgtcgttgacctgattgctgtaacaacaggtttctgtggca |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47544130 |
ttgtctctattcatattaacctctccctgatcagctttctcttcgtctgaggatccacttgtcgttgacctgattgctgtaacaacaggtttctgtggca |
47544031 |
T |
 |
| Q |
101 |
tggaaggagctccagcagggccacactctacagataaataaaatacaaaagacggataacttttataaatttcccatgcaaatgttttctatgttaaact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47544030 |
tggaaggagctccagcagggccacactctacagataaataaaatacaaaagacggataacttttataaatttcccatgcaaatgttttctatgttaaact |
47543931 |
T |
 |
| Q |
201 |
tcataattgcatacaaatgtgtttaacaattcaaaccttttacagtaggctgaagtccaagttcataaggatcagatgtctgtg |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47543930 |
tcataattgcatacaaatgtgtttaacaattcaaaccttttgcagtaggatgaagtccaagttcataaggatcagatgtctgtg |
47543847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 47527761 - 47527660
Alignment:
| Q |
1 |
ttgtctccattcatattaacctctccctgatcagctttctcttcgtctgaggatccacttgtcgttgacctgattgctgtaacaacaggtttctgtggca |
100 |
Q |
| |
|
||||||||||||||||||| |||||| |||| ||| ||| |||||||| ||||||||||| |||||| |||| ||||||| | ||||||| ||||| |
|
|
| T |
47527761 |
ttgtctccattcatattaatctctcc---atcaccttcctcatcgtctgatgatccacttgttgttgacttgat---tgtaacagctggtttctttggca |
47527668 |
T |
 |
| Q |
101 |
tggaagga |
108 |
Q |
| |
|
|| ||||| |
|
|
| T |
47527667 |
tgcaagga |
47527660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 147 - 185
Target Start/End: Original strand, 10266914 - 10266952
Alignment:
| Q |
147 |
aaaagacggataacttttataaatttcccatgcaaatgt |
185 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10266914 |
aaaatacggataacttttataaatttcccatgcaaatgt |
10266952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 101411 - 101322
Alignment:
| Q |
1 |
ttgtctccattcatattaacctctccctgatcagctttctcttcgtctgaggatccacttgtcgttgacctgattgctgtaacaacaggtttc |
93 |
Q |
| |
|
||||||||||||||||||| |||||| |||| ||| | |||||| |||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
101411 |
ttgtctccattcatattaatctctccttgataagcctcatcttcgcctgaggatccacttgtcgttgacctg---gttgtaacaacaggtttc |
101322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University