View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0572_low_22 (Length: 283)
Name: NF0572_low_22
Description: NF0572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0572_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 10 - 276
Target Start/End: Complemental strand, 22364522 - 22364256
Alignment:
| Q |
10 |
ttccaccccacgataatattcgatcatttacaatgtacaacactccattacataaaccggtcatgcaatattttgcatggggtccgtatttttattaagt |
109 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
22364522 |
ttccaccccacgataatattagatcatttacaatgtacaacactccattacataaaccgatcatgcaatagtttgcatggggtccgtatttttattaagt |
22364423 |
T |
 |
| Q |
110 |
gatcatgcaattgtatctcagctctaagacatactccttttcttttctttcttcaaaccgtaggtttcaattgtttggatggcttggaatgaataccatc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22364422 |
gatcatgcaattgtatctcagctctaagacatactccttttcttttctttcttcaaactgtaggtttcaattgtttggatggcttggaatgaataccatc |
22364323 |
T |
 |
| Q |
210 |
attacaaacacatttctcatgtatttctatattattcaaagaccatcatcatttatcccctatgata |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22364322 |
attacaaacacatttctcatgtatttctatattattcaaagaccatcatcatttatcccctatgata |
22364256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University