View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0572_low_23 (Length: 275)
Name: NF0572_low_23
Description: NF0572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0572_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 33 - 223
Target Start/End: Complemental strand, 31801655 - 31801465
Alignment:
| Q |
33 |
gagatgaaaaaggaactattcacgtgcatggtaagccatatgattggtttgacttcattttttaaatatggccatgcacctaccgtatctttgatatact |
132 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31801655 |
gagaagaaaaagaaactattcacgtgcatggtaagccatatgattggtttgacttcattttttaaatatggccatgcacctaccgtatctttgatatact |
31801556 |
T |
|
| Q |
133 |
gtattactgttacgtacatgcattggattaatagctaaataatcgttatatatatctactagataataacgtttcaaccaacatgatttgt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31801555 |
gtattactgttacgtacatgcattggattaatagttaaataattgttatatatatctactagataataacgtttcaaccaacatgatttgt |
31801465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 306 times since January 2019
Visitors: 3833