View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0572_low_29 (Length: 251)
Name: NF0572_low_29
Description: NF0572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0572_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 74 - 228
Target Start/End: Original strand, 34647382 - 34647536
Alignment:
| Q |
74 |
cgatggctacaattaagaggccctgtgtgactcgattgacacgagcataaccaacacaagtagtaacaaccggcaacaggacaatataatggacaccagg |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34647382 |
cgatggctacaattaagaggccctgtgtgactcgattgacacgagcataaccaacacaagtagtaacaaccggcaacaggacaatataatggacaccagg |
34647481 |
T |
 |
| Q |
174 |
ggaattttttggcacatcattcatacattgaagaattaatgatcttgcatttcta |
228 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34647482 |
ggaatttttgggcacatcattcatacattgaagaattaatgatcttgcaattcta |
34647536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University