View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0572_low_32 (Length: 217)
Name: NF0572_low_32
Description: NF0572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0572_low_32 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 45345125 - 45344989
Alignment:
| Q |
1 |
agacaggatattgttcgacctgtcgaagcaatttgtggtggtgaccttgaaagtgagatggaagaccaacaaaaccatcctaatttgggcaaaggagaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45345125 |
agacaggatattgttcgacctgtcgaagcaatttgtggtggtgaccttgaaagtgagatggaagaccaacaaaaccatcctaatttgggcaaaggagaca |
45345026 |
T |
|
| Q |
101 |
gtctggtggggaatgatcaagccaatagttcttcatc |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45345025 |
gtctggtggggaatgatcaagccaatagttcttcatc |
45344989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 157 times since January 2019
Visitors: 3833