View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0572_low_34 (Length: 210)
Name: NF0572_low_34
Description: NF0572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0572_low_34 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 3 - 139
Target Start/End: Complemental strand, 47544651 - 47544515
Alignment:
| Q |
3 |
agagagtattgatccaagtagtaggtttctataacaagttttactagtaaagtagttaaatcaaggacttaccttcgcttttattgtttcaaaatcagcg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47544651 |
agagagtattgatccaagtagtaggtttctataacaagttttactagtaaagtagttaaatcaaggacttaccttcgcttttattgtttcaaaatcagcg |
47544552 |
T |
|
| Q |
103 |
tttaatattctgttctcaacagcagaattgttatatt |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47544551 |
tttaatattctgttctcaacagcagaattgttatatt |
47544515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 47528544 - 47528411
Alignment:
| Q |
1 |
gcagagagtattgatccaagtagtaggtttctataacaagttttactagtaaagtagttaaatcaaggacttaccttcgcttttattgtttcaaaatcag |
100 |
Q |
| |
|
||||||| | ||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| ||||| |
|
|
| T |
47528544 |
gcagagaattttgatccaagtagtaggcttctataaccagttttactagtaaagtagttaaatcaaggacttaccttcgctcttaatgtttcaacatcag |
47528445 |
T |
|
| Q |
101 |
cgtttaatattctgttctcaacagcagaattgtt |
134 |
Q |
| |
|
| |||||||||||||| ||||||||||||||||| |
|
|
| T |
47528444 |
cttttaatattctgttgtcaacagcagaattgtt |
47528411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1229 times since January 2019
Visitors: 3841