View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0573_low_15 (Length: 260)
Name: NF0573_low_15
Description: NF0573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0573_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 8 - 250
Target Start/End: Original strand, 3430127 - 3430369
Alignment:
Q |
8 |
ataattttctatcaaattttatttatctctaatgtgcgaaacgttgaattatcaagttttatgtttctttattagttctaacatttcaagaaactacgtt |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
3430127 |
ataattttctatcaaattttatttatctctaatgtgcgaaacgttgaattatcaagttttatgtttctttattagttctaacatttcaaggaactacgtt |
3430226 |
T |
 |
Q |
108 |
aactttattagacttgagaaagattcacatatatcgtattcgattgcttttgaatttcactatttctcattcggctaaaccttaattcgactgcttgccg |
207 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3430227 |
aactttattagacttgagaaagattcatatatatcgtattcgattgcttttgaatttcactatttctcattcggctaaaccttaattcgactgcttgccg |
3430326 |
T |
 |
Q |
208 |
ttcttggctaacaacataactatttttagatatatacaatatt |
250 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3430327 |
ttcttggctaacaacataactatttttagatatatacaatatt |
3430369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University