View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0573_low_2 (Length: 445)
Name: NF0573_low_2
Description: NF0573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0573_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 68; Significance: 3e-30; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 235 - 306
Target Start/End: Original strand, 42031532 - 42031603
Alignment:
| Q |
235 |
cttgtgttacagaacatttctctagaatggaaatatgagaatggatattttcatttttatattagtacatca |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42031532 |
cttgtgttacagaacatttctctagaatggaaatatgagaatggatgttttcatttttatattagtacatca |
42031603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 373 - 431
Target Start/End: Original strand, 42031670 - 42031728
Alignment:
| Q |
373 |
cggatttacttcgacataaggtggtttctttgaaggtgtttttacttgcttgacgtctt |
431 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42031670 |
cggatttactttgacataagacggtttctttgaaggtgtctttacttgcttgacgtctt |
42031728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 52 - 153
Target Start/End: Original strand, 27910902 - 27911003
Alignment:
| Q |
52 |
atgatgtttggatctcttaatgggaaatcgattctgaagtctagaattgattttagcataagcaactccttgtagcttttgcatctaggtgaattgattc |
151 |
Q |
| |
|
||||||||||| ||||| || || |||| |||| ||||| ||||||||||||||| | |||| |||||||| ||||| ||| ||| |||||||||||| |
|
|
| T |
27910902 |
atgatgtttgggtctctgaagggaaaattgattatgaagcctagaattgattttactagaagctactccttggagcttctgcgtcttcgtgaattgattc |
27911001 |
T |
 |
| Q |
152 |
ta |
153 |
Q |
| |
|
|| |
|
|
| T |
27911002 |
ta |
27911003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University