View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0573_low_4 (Length: 385)
Name: NF0573_low_4
Description: NF0573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0573_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 20 - 291
Target Start/End: Complemental strand, 35251663 - 35251389
Alignment:
Q |
20 |
caacaaaataacagaagcttgatcttggctgatttaacggtggagatcgcaagtaaccgaaacctctgttcaatccgacggttcaaccaacagctccctc |
119 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35251663 |
caacaaaataacagaagcttgatcttggctgatttaacggtggagatcgcaagtaaccgaaacctctgttcaatccgacggttcaaccaacagctccctc |
35251564 |
T |
 |
Q |
120 |
tcatcaccgccgctaataacaagaaaatctaaatnnnnnnn---ccaaaaccggttcggttcagtaacgaaccaagaaaaccttcatttcgaaccggagc |
216 |
Q |
|
|
|||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35251563 |
tcatcaccgccgctaataacaacaaaatctaaataaaaaaaaaaccaaaaccggttcggttcagtaacgaaccaagaaaaccttcatttcgaaccggagc |
35251464 |
T |
 |
Q |
217 |
ttctgattagtttaagattttaacgtgtcttggatcatgaaaatggaagaggattcgtttgttttcgatggttaa |
291 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35251463 |
ttctgattagtttaagattttaacgtgtcttggatcatgaaaatggaagaggattcgtttgttttcgatggttaa |
35251389 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University